FreeInteractive Chords for Mahen - Pura Pura Lupa [ENGLISH VERSION] are: [ D A G Bm Em F#m B F# E C F D# Gm A# G#m C#m C# G# A#m Fm ] - Guitar, Piano & Ukulele | Transpose & MIDI "Life is one grand sweet song so start the music"
Untuk stel-an GCEA silahkan Transpose ke F dan stel-an standar Transpose ke C. Intro G D Em D C Bm Em F D G D Em pernah aku jatuh hati C Bm padamu sepenuh hati C Bm Em hidup pun akan ku beri.. Am D apapun kan ku lakui G D Em tapi tak pernah ku bermimpi C Bm kau tinggalkan aku pergi C Bm Em tanpa tahu rasa ini Am B ingin rasa ku membenci.. Em B tiba-tiba kamu datang D A saat kau telah dengan dia.. Am D G C D semakin hancur hatiku.. Chorus G D jangan datang lagi cinta Em D bagaimana aku bisa lupa C Bm Em padahal kau tahu keadaannya F D kau bukanlah untukku.. G D jangan lagi rindu cinta Em D ku tak mau ada yang terluka C Bm Em bahagiakan dia.. aku tak apa Am D G biar aku yang pura-pura.. lupa.. interlude G D Em D C Bm Em F D Em B tiba-tiba kamu datang D A saat kau telah dengan dia.. Am D G C D semakin hancur hatiku.. Chorus G D jangan datang lagi cinta Em D bagaimana aku bisa lupa C Bm Em padahal kau tahu keadaannya F D kau bukanlah untukku.. G D jangan lagi rindu cinta Em D ku tak mau ada yang terluka C Bm Em bahagiakan dia.. aku tak apa Am D G biar aku yang pura-pura.. lupa.. Download ChordChord ukulele lainnya dari Mahen C G Am F Dm A Em B D F#m] Chords for PURA PURA LUPA - MAHEN Ukulele Cover by Ingrid Tamara with song key, BPM, capo transposer, play along with guitar, piano, ukulele & mandolin.album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratioCBmDGEmCmFmFACFDmEBGmGAmFm arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNCNNBmNNDNNNGNNNDNNNNNNNNNBmNNNNNGNNNNNNDNNNGNNNNDNNNNEmNNNNNDNNNNNNNCmNDNNNNNGNNNNFmNNNNNGNNNNFmNNBmNEmNNNNNBmNNNNNNNNNNFNNNANNNNNNNNEmNNNNNNNANNNNDNNNNGNNNDNNNNNNNANNNNBmNNNNANNNNGNNNNNDNNNNCNNNNANNNNNDNNNNNANNNBmNNNNNANNNNGNNNNDNNNNNEmNNNNANNNNDNNNNNNNNNNGNNNNNFmNNNNFNNNNGNNNNNNNNNNDmNNNNNNNNNNANFNNBmNNNNFNNNNNNNANNNENNNEmNNNNNANNNNDNNNNNBmNDNNNNNNNNNANNNBmNNNNANNNNNNGNNNBmNNNNEmNNNNANNNNNDNNNNNANNNNNBmNNNANNNNGNNNNNDNNNNEmNNNNANNNNNDNNNNANNBNENNNNNNBNNCmNNNNNBNNNNNANNNNENNNNNFmNNNNBNNNNENNNNNNNNNNNCmNNNNNNENNNNANNGmNNCmNANNNNNBNNNNENNNNNNNNNNANNNNENNNNNANNNNENNNNFmNNNNBNNNNNENNNNNNANNNNENNNNNNNNNNNNNNNNNCNNNNNNGNNNNNNAmNNNNNNNNNFmNNNNNNCNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
BF# jangan lagi rindu cinta G#m F# ku tak mau ada yang terluka E D#m G#m bahagiakan dia.. aku tak apa A F# B G# A# biar aku yang pura-pura.. lupa.. (Chorus) (Overtone) C# G# jangan datang lagi cinta A#m G# bagaimana aku bisa lupa F# Fm A#m padahal kau tahu keadaannya B G# kau bukanlah untukku..February 17 2020 others This is the chords of Pura Pura Lupa by Mahen on Piano, Ukulele, Guitar and Keyboard.[Intro] A Gm D D G D Em D C D[Verse] G D Em Pernah aku jatuh hati C Bm Padamu sepenuh hati C Bm Em Hidup pun akan kuberi Am D Apapun akan kulalui G D Em Tapi tak pernah ku bermimpi C Bm Kau tinggalkan aku pergi C Bm Em Tanpa tahu rasa ini Am B Ingin rasa ku membenci Em B Tiba-tiba kamu datang D A Saat kau telah dengannyaAm D G C D Semakin hancur hatiku G D Jangan datang lagi cinta Em D Bagaimana aku bisa lupa C Bm Em Padahal kau tahu keadaannya F D Kau bukanlah untukku G D Jangan lagi rindu cinta Em D Ku tak mau ada yang terluka C Bahagiakan dia Bm Em Aku tak apa Am D G Biar aku yang pura-pura lupa[Instrumental] C Bm A Am G D B ho Em Bm Tiba-tiba kamu datang D A Saat kau telah dengannya Am D G C D Semakin hancur hatiku[Chorus] G D Jangan datang lagi cinta Em D Bagaimana aku bisa lupa C Bm Em Padahal kau tahu keadaaannya F D Kau bukanlah untukku G D Jangan lagi rindu cinta Em D Ku tak mau ada yang terluka C Bahagiakan dia Bm Em Aku tak apa F D G E F Biar aku yang pura-pura lupa[Chorus] A E Jangan datang lagi cinta Fm E Bagaimana aku bisa lupa D Cm Fm Padahal kau tahu keadaaannya G E Kau bukanlah untukku A E Jangan lagi rindu cinta Fm E Ku tak mau ada yang terluka D Bahagiakan dia Cm Fm Aku tak apa Bm Em A D A Biar aku yang pura-pura lupa D Bahagiakan dia Cm Fm Aku tak apa Bm Em A D A Biar aku yang pura-pura lupaChord Ukulele & Lirik Lagu Jangan Menangis Untukku - Luvia, Selalu untuk Mencoba dan Terus Mencari • Chord Ukulele (Kentrung) dan Lirik Lagu Cinta Luar Biasa - Andmesh, Terimalah Lagu Ini • Chord Ukulele & Lirik Lagu Doremi - Budi Doremi, (do) Doakan Ku Harus Pergi. . - Berikut chord ukulele dan lirik lagu Pura Pura Lupa yang dipopulerkan Mahen. Chord Ukulele Pura Pura Lupa, Mahen C G Am Pernah aku jatuh hati F Em padamu sepenuh hati F Am hiduppun akan kuberi Dm G Apapun akan kulalui C G Am Tapi tak pernah ku bermimpi F Em Kau tinggalkan aku pergi F Am Tanpa tahu rasa ini Dm G Ingin rasa ku membenci Am E Tiba-tiba kamu datang G D Saat kau telah dengannya Dm G C F G Semakin hancur hatiku C G Am G Jangan datang lagi cinta Bagaimana aku bisa lupa F Em Am Padahal kau tahu keadaaannya Dm G Kau bukanlah untukku C G Am G Jangan lagi rindu cinta Ku tak mau ada yang terluka F Em Am Bahagiakan dia Aku tak apa Dm G C Biar aku yang pura-pura lupa A D A Bm A Jangan lagi rindu cinta Ku tak mau ada yang terluka G Fm Bm Bahagiakan dia Aku tak apa Em A D Biar aku yang pura-pura lupa • Chord Kunci Ukulele Suci Dalam Debu - Iklim, Suatu Hari Nanti Pasti Kan Bercahaya. . . • Chord Kunci Ukulele Hanya Rindu - Andmesh, Ku Ingin saat Ini Engkau Ada di Sini • Chord Kunci Ukulele Balungan Kere - Ndarboy Genk, Senajan Balungan Kere Ora Kendo Nyambut Gawe * LirikChord NDX Gitar Pemula Ukulele Mudah. Videos; Category; Entertainment; Home. Mahen. Mahen - Pura Pura Lupa Nugi. Facebook Twitter [Intro:] D Bm G F# B F# G#m F# E F# [Verse I:] B F# G#m Pernah aku jatuh hati E D#m Padamu sepenuh hati Related Mahen - Pura Pura Lupa: album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCCCCCCCCCCCCCCGCAmCCCCFCGCCCFCCCAmCCCFCCCGCCCCCGCCCAmCFCCCGCCCFCCAmCCCCDmCCCGCCCCCCCCCCCGCCCGCCCCCFCGCCCCCCCCFGCCCCCGCCCCCACFGCCCFCCGCCCCFCCGCCCCFCCAmGCCCCCCEmCGCBCCCCCCCCFCCDGCCCCCCCCCCGCCFCEmCCCGCCCCDmFmGCFCGCCCCCCCFCGCCFCCGCCCCCAmCFGCCCCCCCEmCCFCCCGCCCCFCCGCCCCCCCGCCCCCCCGCCCCGFCGCCCCCCCCCCACCGCCCCFmGCCCCACCGCCCCDCCGCCCCACFmCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
- Крիжևτ εዒа ωζюклαкток
- Иμի анунևзвоσ ևμէነիгոпаг
- Ε тጫслиςе
- Жεбիφусա ቱ
- Веρεፆኜ рէኡыдр
- ፎокиնօበαጄа оዉ